Judge Throws Out Sham Bullet Forensics

[Naperville]

This will be appealed, and if it sticks many thousands will get new cases if they were decided on bullet forensics.

Legal Documents


Overview
https://www.naturalnews.com/2025-10-01- ... nsics.html

[Doc Dan]

Sanctified Bovine! That opened a can of worms!

[Bolster]

Super interesting! Thanks for posting

[zenith2]

I remember an article on this a few years ago from Maryland. Found it.

https://www.wusa9.com/article/news/loca ... 0794815197

For me, the concerning part was:

“There was a study called Ames 2, and what that study found that when they tried to reproduce the opinions of one examiner versus another examiner, they found that over 50% of the time, the second examiner came to a different conclusion on the same evidence than the first examiner," Gilleran explained.”

[Naperville]

I remember an article on this a few years ago from Maryland. Found it.

https://www.wusa9.com/article/news/loca ... 0794815197

For me, the concerning part was:

“There was a study called Ames 2, and what that study found that when they tried to reproduce the opinions of one examiner versus another examiner, they found that over 50% of the time, the second examiner came to a different conclusion on the same evidence than the first examiner," Gilleran explained.”

YES, and what is even more crazy is that showing the same examiner the groves and landings at a later date they came to different conclusions about the weapon.

[zenith2]

I remember an article on this a few years ago from Maryland. Found it.

https://www.wusa9.com/article/news/loca ... 0794815197

For me, the concerning part was:

“There was a study called Ames 2, and what that study found that when they tried to reproduce the opinions of one examiner versus another examiner, they found that over 50% of the time, the second examiner came to a different conclusion on the same evidence than the first examiner," Gilleran explained.”

YES, and what is even more crazy is that showing the same examiner the groves and landings at a later date they came to different conclusions about the weapon.

If this continues many people that have been convicted with ballistic forensics will have grounds to appeal.

For context outside of the US.

Here in South Africa when a firearm is sent for ballistic forensics the general waiting period is two years, some wait longer, and there has been a few reports of firearms damaged during this process/handling and storing.

We have seen case arguments follow trend from the US, especially if science is debated, so I am anticipating someone will make an argument in light of these latest developments.

[Naperville]

I remember an article on this a few years ago from Maryland. Found it.

https://www.wusa9.com/article/news/loca ... 0794815197

For me, the concerning part was:

“There was a study called Ames 2, and what that study found that when they tried to reproduce the opinions of one examiner versus another examiner, they found that over 50% of the time, the second examiner came to a different conclusion on the same evidence than the first examiner," Gilleran explained.”

YES, and what is even more crazy is that showing the same examiner the groves and landings at a later date they came to different conclusions about the weapon.

If this continues many people that have been convicted with ballistic forensics will have grounds to appeal.

For context outside of the US.

Here in South Africa when a firearm is sent for ballistic forensics the general waiting period is two years, some wait longer, and there has been a few reports of firearms damaged during this process/handling and storing.

We have seen case arguments follow trend from the US, especially if science is debated, so I am anticipating someone will make an argument in light of these latest developments.

I expect that given experts cannot agree with their own work, this method of prosecution will be dropped.

[Doc Dan]

I think they will try AI. But, AI is only as smart as the ones that programmed it. It will use ground knowledge and include the developer's unknown biases. But, they will still try this to make it more accurate. (it won't)

[shunsui]

Not to derail the topic, but this reminded me of the fingerprint controversy so I used Google's Search A.I. to see what happened with all that. This might be where bullet forensics may be going.

A.I. Deeper Dive:

The controversy over the reliability of fingerprint science has led to significant reforms but has not been definitively "resolved".

While fingerprint evidence is still widely used and generally admissible in court, its perceived infallibility has been replaced with a more scientifically grounded understanding of its limitations.

Research has improved the methodology, but courts increasingly acknowledge its subjective components and known error rates.

Key challenges and developments

Subjectivity of analysis: Traditional fingerprint analysis relies on the subjective judgment of an examiner to determine a match using the ACE-V (Analysis, Comparison, Evaluation–Verification) method. This was a core issue raised in legal challenges under the Daubert standard, which requires scientific evidence to have been adequately tested and to have a known error rate.

Misidentifications: Landmark cases of misidentification, such as the 2004 Madrid train bombing case and the exoneration of Stephan Cowans, revealed flaws in the reliance on absolute expert certainty.

Lack of scientific testing: Critics pointed out that decades of routine use had not been backed by rigorous, empirical scientific testing to validate the core claims of permanence and uniqueness.

Biased interpretation: Concerns were raised that extraneous information about a case could cognitively bias an examiner's judgment.

Reforms and ongoing issues

Black box studies:

The National Institute of Justice (NIJ), in conjunction with the FBI, published the results of a 2011 "black box" study to test the accuracy of forensic fingerprint decisions.

Study findings: The study reported an impressive, but non-zero, error rate. It found a false positive rate of 0.1% (one misidentification in 1,000) and a higher false negative rate.

Impact: This study confirmed that human error is possible, debunking the myth of infallibility and reinforcing the need for caution in testimony.

Limitations on expert testimony: As a result of these developments, court rulings have placed limits on how experts can testify.

Some courts prohibit examiners from claiming "100% certainty" or stating that a print belongs to a specific individual "to the exclusion of all others". Instead, experts are instructed to give more scientifically grounded testimony that acknowledges the inherent limitations and potential for error.

Ongoing scientific inquiry: Research continues to strengthen the scientific foundation of fingerprint analysis, including advances in visualization techniques for "Level 3" microscopic features like pores and ridges. There are also ongoing efforts to integrate artificial intelligence (AI) to improve matching accuracy and uncover new forensic markers.

Contested admissibility, but no exclusion: While defense attorneys regularly challenge the admissibility of fingerprint evidence based on scientific uncertainty, courts have consistently allowed it, acknowledging its reliability even with its subjective elements.

The emphasis is now on cross-examination to highlight any potential weaknesses in the analysis.

Conclusion

The fingerprint science controversy was not "resolved" in the sense that all scientific doubt was removed. Rather, the justice system adapted to a more realistic and scientifically honest understanding of the evidence. The key shift has been from treating fingerprint identification as an infallible science to acknowledging it as a reliable, though fallible, form of expert evidence. This has led to more precise testimony, increased scrutiny in court, and ongoing research to enhance the method's accuracy and validity.

[SpyderEdgeForever]

What causes errors in fingerprints as evidence in crimes, if each finger print is unique and computers can now scan and match the lines to the fingers?

[Naperville]

What causes errors in fingerprints as evidence in crimes, if each finger print is unique and computers can now scan and match the lines to the fingers?

Computers are excellent at this type of analysis, but I think humans have to review whatever is presented from the database. Must be reviewed by humans before going to court.

Did you know that if they find DNA at a crime scene they generally DO NOT process the entire strand of DNA! They may process 5% to 10% of it and look for a match. If the agency had a database with every human in it, there could be multiple collisions or matches. Then they look at the other facts:

- desire to commit the crime against the victim
- time of crime
- place of crime
- location of DNA matches
- opportunity to commit crime

To process the full DNA strand is not necessary for a court case.

There may be several people alive on Earth with MOST of your DNA. It is unlikely. And if they sequence the entire DNA strand it is even less likely but not impossible.

[SpyderEdgeForever]

Naperville, thank you for that info. I had no idea that they did not process all the DNA.
I thought that because it is so serious, the very lives of people, that they processed every bit of whatever sample they had. They need to be as meticulous and careful as possible.

[Naperville]

Naperville, thank you for that info. I had no idea that they did not process all the DNA.
I thought that because it is so serious, the very lives of people, that they processed every bit of whatever sample they had. They need to be as meticulous and careful as possible.

For a paternity test, the compare just 20 "locus" points. The human genome contains over 8,000 mapped loci. It's a good enough test.

The statistical for a match for DNA is never 100% because they would have to test all humans alive or deceased since the given crime was committed.

It is generally accurate as long as they have the right DNA samples. Crime scenes might contain 2, 20, or 2,000 different DNA samples. The investigators try to take as many DNA samples back to the lab as possible so they do not miss a possible suspect.

As I said, even if they had the entire planet in the database they rule out matches based on logic. But they build a case on perps as if they are the only match.

All that I know is I didn't do it. I hardly ever leave the house!

[Naperville]

I just Googled something!!! In order to prosecute you for a crime they test only 13 to 20 loci.

"To prosecute someone using DNA evidence, typically 13 to 20 STR (short tandem repeat) loci are tested, and the specific alleles at each of these loci are compared to create a unique DNA profile. A match at a sufficient number of loci provides strong evidence, but a DNA profile alone is rarely enough for a conviction; it is usually used alongside other evidence like witness testimony or a confession."

The human race has around 50,000 different alleles.

[Mage7]

Naperville, thank you for that info. I had no idea that they did not process all the DNA.
I thought that because it is so serious, the very lives of people, that they processed every bit of whatever sample they had. They need to be as meticulous and careful as possible.

For a paternity test, the compare just 20 "locus" points. The human genome contains over 8,000 mapped loci. It's a good enough test.

The statistical for a match for DNA is never 100% because they would have to test all humans alive or deceased since the given crime was committed.

It is generally accurate as long as they have the right DNA samples. Crime scenes might contain 2, 20, or 2,000 different DNA samples. The investigators try to take as many DNA samples back to the lab as possible so they do not miss a possible suspect.

As I said, even if they had the entire planet in the database they rule out matches based on logic. But they build a case on perps as if they are the only match.

All that I know is I didn't do it. I hardly ever leave the house!

Well, if I remember correctly, each human being's DNA is 99.99% the same from one person to another, and it's only the .01% that is unique.

That got me thinking about how complex it really is. It doesn't really sound like 20 loci is a lot to ensure true uniqueness, but if you compare it to something like the possible combinations of a 256 bit number it creates kind of an interesting way to think about it. For example, a 256 bit "value space" could have between 1 and 18 quintillion different unique numbers within in. A common way to talk about it in computer science is to point out that it would take longer than the current age of the universe, by several factors, to guess every 256 bit value that could have produced a piece of data that was produced with AES. In other words, if you had a padlock with 256 tumblers that could be either 0 or 1, the combination to open it would be 1 out of 18 quintillion.

On the other hand, loci are really complex. They're patterns of patterns. While there are 8,000 loci, there's 3.2 billion base pairs in all. Supposing it's true that only .01% of those are unique and the rest are all the same, you could consider that padlock as having 32 million tumblers, and each one could be a value of 1, 2, 3 or 4 (A, C, T, G). In other words, the possible combinations of the 256 bit AES padlock is 2^64, but the possible combinations of the DNA padlock--in just the portion which is unique among human beings--would be 4^32,000,000.

Except loci are, again, patterns of patterns. So instead of considering A, C, T or G, the patterns for mapped loci can be half a dozen to dozens of those pairs, and if there are about 8,000 unique ones you can't really calculate a flat range of possibilities by doing something like 4^8,000 because not every pattern will contain all 4 pairs, and the compound nature of it means the size of a pattern that can be formed isn't really definable. You might have AC, ACT, ACAT, TACA, ACATTACA, every permutation of each respective pattern, and every permutation of ACACTACATTACAACATTACA, all combined. It's quite literally like calculating how many different unique human beings are possible to be made.

Another way to think of it... Say that the James Webb telescope can only image 13-20 galaxies per frame. How many stars, planets, and solar systems, respectively, are in each galaxy? Then, how many frames out of a million unique sections of the sky imaged might have the same combination of planets, stars, solar systems and galaxies?

[Naperville]

...

Another way to think of it... Say that the James Webb telescope can only image 13-20 galaxies per frame. How many stars, planets, and solar systems, respectively, are in each galaxy? Then, how many frames out of a million unique sections of the sky imaged might have the same combination of planets, stars, solar systems and galaxies?

I don't know how you came up with that but it is brilliant. It really is what we are dealing with.

For this, the other sections of the sky would be the same and only the frames would be different.

It really is complex, and I am guessing that 13 to 20 sites is enough for most things.

As I said before:
- they usually have other statements, other data or witnesses
- you have to have had an opportunity to commit the crime

[Mage7]

As I said before:
- they usually have other statements, other data or witnesses
- you have to have had an opportunity to commit the crime

Yeah the interesting thing to me is that for all the scientific pomp of forensics and DNA evidence, most of it ends up being used as any other piece of circumstantial evidence would be anyway. Sometimes a killer's DNA being present at the scene is all that they have, yet somehow a lot of people seem to be more persuaded by that than something like their brand of cigarettes or their sunglasses left there or something.

I tend to think it's not even so much that the cigarettes and sunglass left at the scene don't convince people, but whether or not this convinces them beyond a reasonable doubt. A good defense attorney would bring up how common and popular the brands are, and insist that some other individual must have left them there and that just because the prosecution has several pictures of the alleged killer wearing said sunglasses and smoking said cigarettes, doesn't prove that the ones found at the scene were his. You throw in that they found his DNA on one of the butts in the ash tray, though, and then suddenly it really clinches beyond any doubt that he was there... But in reality all it really proves is he smoked a cigarette in the same location the crime was committed. That's usually enough to prove it, especially if he had the means and the motive, and usually it also helps to only reveal the DNA evidence after a defendant had lied about not being there. In the end though it's still using a scientific certainty that they were there to support an overlying case that's mostly circumstantial.

It makes me think of the OJ Simpson trial... How different might that have been if they could show his DNA was inside the glove? Weird to think about considering that even if the glove had fit, all it would have proved is that the glove fit. DNA would have proved that he wore that very specific glove, and the defense would have had to come up with some cockamamie story for how it got there.

From the little bit scrutiny of ballistic forensics testing I've seen, it's usually only ever serving to prove a circumstantial idea anyway. They can say a gun used in the crime definitely belonged to, or could be linked to the defendant, and then based on that use all of the other things like witness testimony, examining motive, etc. as well to secure a conviction. Most of the time the cases are pretty strong and the ballistics evidence is just sort of the cherry on top to convince them if they don't take a plea deal that they'll definitely lose. Defense attorneys and prosecutors both refer to it as the "CSI Effect" where the presence of forensic evidence is much more likely to convince a jury of a circumstantial case, and conversely just as likely to make them more skeptical of the same set of circumstantial evidence in the absence of forensic evidence. So when your defense team tells you, "Well, they have forensic evidence," it's more like saying, "The jury is definitely going to find you guilty, so you're better off taking this plea deal."

I'm mostly familiar with this kind of stuff as a lay person because I am a supporter of the Innocence Project. It reminds me of the way forensic bite evidence has been absolutely proven to be entirely unreliable and in many cases completely fabricated. In Mississippi, for example, a crooked dentist and a county coroner were responsible for prosecuting a huge number of cases where it was revealed the dentist basically made up a load of sham science to get convictions. Even though the "science" of the evidence has been thoroughly debunked, the state of Mississippi refuses to grant an appeal for the most of the cases. They and the "forensic odontologist" claim that the cases are strong enough based on other circumstancial evidence alone. The Netflix documentary is called "The Innocence Files" and the specific episodes Michael West (the sham scientist) are interviewed in are 1 and 3, and while I'm sure the film makers went out of their way to make him look like a horrible human being, I can't imagine it was a lot of work. The book "The Cadaver King and the Country Dentist: A True Story of Injustice in the American South" also goes into great detail about all of it.

I can't really imagine that many cases actually being overturned by this ruling if they haven't been overturned due to phony bite-evidence "science". It's basically down to the difficulty of the appeals process in general. In many of the Mississippi cases, it's questionable whether the marks in question are even bites, or if the victim was actually murdered, let alone whether or not the convicted person was the person who bit and murdered them. When it comes to ballistics evidence, there's no uncertainty that victims were killed by a gunshot, and so I think in actuality states will be more likely to allow such cases to go to trial on appeal because they'll be confident that the other circumstancial evidence they had will still likely sway a jury. It's still a win for people worried about the prosecutorial malpractice of shuttling people into the prison system on what is essentially an expressway facilitated by plea deals, because without the "CSI Effect" of the ballistics, defendants are more likely to actually go to trial and let a jury decide.

There's another amazing case that was featured on the show "Forensic Files," titled plastic fire that was kind of interesting because that show is generally depicts forensic science as infallible, and so it is a great acknowledgement on their part about how it can be mistaken, but also an exploration of how the same science can be used correctly find the truth. In it a woman named Sheila Bryan was accused of starting a vehicle fire that killed her mother after forensic arson investigators insisted that the presence of petrochemicals pooled on the floorboard indicated an accelerant was poured and ignited. Ultimately it was discovered that the ignition switch of the vehicle in question had been under recall for causing vehicle fires, and the pool of petrochemicals discovered was from the plastic shroud surrounding the ignition melting and spilling to the floor.

Another great docu series is called 'Exhibit A' and it explores several fields of forensic evidence, including "Touch DNA". Not sure if it's still on Netflix, but it's worth a watch if you're interested in this kind of thing. It pairs pretty well with that "Making a Murderer" series since so much of that was also based on touch DNA evidence.

[Naperville]

As I said before:
- they usually have other statements, other data or witnesses
- you have to have had an opportunity to commit the crime

Yeah the interesting thing to me is that for all the scientific pomp of forensics and DNA evidence, most of it ends up being used as any other piece of circumstantial evidence would be anyway. Sometimes a killer's DNA being present at the scene is all that they have, yet somehow a lot of people seem to be more persuaded by that than something like their brand of cigarettes or their sunglasses left there or something.

I tend to think it's not even so much that the cigarettes and sunglass left at the scene don't convince people, but whether or not this convinces them beyond a reasonable doubt. A good defense attorney would bring up how common and popular the brands are, and insist that some other individual must have left them there and that just because the prosecution has several pictures of the alleged killer wearing said sunglasses and smoking said cigarettes, doesn't prove that the ones found at the scene were his. You throw in that they found his DNA on one of the butts in the ash tray, though, and then suddenly it really clinches beyond any doubt that he was there... But in reality all it really proves is he smoked a cigarette in the same location the crime was committed. That's usually enough to prove it, especially if he had the means and the motive, and usually it also helps to only reveal the DNA evidence after a defendant had lied about not being there. In the end though it's still using a scientific certainty that they were there to support an overlying case that's mostly circumstantial.

It makes me think of the OJ Simpson trial... How different might that have been if they could show his DNA was inside the glove? Weird to think about considering that even if the glove had fit, all it would have proved is that the glove fit. DNA would have proved that he wore that very specific glove, and the defense would have had to come up with some cockamamie story for how it got there.

From the little bit scrutiny of ballistic forensics testing I've seen, it's usually only ever serving to prove a circumstantial idea anyway. They can say a gun used in the crime definitely belonged to, or could be linked to the defendant, and then based on that use all of the other things like witness testimony, examining motive, etc. as well to secure a conviction. Most of the time the cases are pretty strong and the ballistics evidence is just sort of the cherry on top to convince them if they don't take a plea deal that they'll definitely lose. Defense attorneys and prosecutors both refer to it as the "CSI Effect" where the presence of forensic evidence is much more likely to convince a jury of a circumstantial case, and conversely just as likely to make them more skeptical of the same set of circumstantial evidence in the absence of forensic evidence. So when your defense team tells you, "Well, they have forensic evidence," it's more like saying, "The jury is definitely going to find you guilty, so you're better off taking this plea deal."

I'm mostly familiar with this kind of stuff as a lay person because I am a supporter of the Innocence Project. It reminds me of the way forensic bite evidence has been absolutely proven to be entirely unreliable and in many cases completely fabricated. In Mississippi, for example, a crooked dentist and a county coroner were responsible for prosecuting a huge number of cases where it was revealed the dentist basically made up a load of sham science to get convictions. Even though the "science" of the evidence has been thoroughly debunked, the state of Mississippi refuses to grant an appeal for the most of the cases. They and the "forensic odontologist" claim that the cases are strong enough based on other circumstancial evidence alone. The Netflix documentary is called "The Innocence Files" and the specific episodes Michael West (the sham scientist) are interviewed in are 1 and 3, and while I'm sure the film makers went out of their way to make him look like a horrible human being, I can't imagine it was a lot of work. The book "The Cadaver King and the Country Dentist: A True Story of Injustice in the American South" also goes into great detail about all of it.

I can't really imagine that many cases actually being overturned by this ruling if they haven't been overturned due to phony bite-evidence "science". It's basically down to the difficulty of the appeals process in general. In many of the Mississippi cases, it's questionable whether the marks in question are even bites, or if the victim was actually murdered, let alone whether or not the convicted person was the person who bit and murdered them. When it comes to ballistics evidence, there's no uncertainty that victims were killed by a gunshot, and so I think in actuality states will be more likely to allow such cases to go to trial on appeal because they'll be confident that the other circumstancial evidence they had will still likely sway a jury. It's still a win for people worried about the prosecutorial malpractice of shuttling people into the prison system on what is essentially an expressway facilitated by plea deals, because without the "CSI Effect" of the ballistics, defendants are more likely to actually go to trial and let a jury decide.

There's another amazing case that was featured on the show "Forensic Files," titled plastic fire that was kind of interesting because that show is generally depicts forensic science as infallible, and so it is a great acknowledgement on their part about how it can be mistaken, but also an exploration of how the same science can be used correctly find the truth. In it a woman named Sheila Bryan was accused of starting a vehicle fire that killed her mother after forensic arson investigators insisted that the presence of petrochemicals pooled on the floorboard indicated an accelerant was poured and ignited. Ultimately it was discovered that the ignition switch of the vehicle in question had been under recall for causing vehicle fires, and the pool of petrochemicals discovered was from the plastic shroud surrounding the ignition melting and spilling to the floor.

Another great docu series is called 'Exhibit A' and it explores several fields of forensic evidence, including "Touch DNA". Not sure if it's still on Netflix, but it's worth a watch if you're interested in this kind of thing. It pairs pretty well with that "Making a Murderer" series since so much of that was also based on touch DNA evidence.

Thank you for the very thorough reply. Your involvement with the Innocence Project and the book recommendations really make your post stand out.

Just a hunch, but I think OJ was guilty. I don't think most of the people on the jury would have declared him guilty though. My gut feeling on the DRY blood soaked glove is that after leather is wet, it can shrink just a bit making the fit difficult. I can only imagine what must have been going through his mind when he had to put the glove back on. OJ had the best legal team and it bankrupted him. He took no chances at the trial.

My interest in DNA is based on having worked in Silicon Valley for a biotech involved in genomics work.